Splice junction site sequence logos of PtiICS in comparison with... | Download Scientific Diagram
Splicing in action: assessing disease causing sequence changes | Journal of Medical Genetics
A single m6A modification in U6 snRNA diversifies exon sequence at the 5' splice site | Nature Communications
GitHub - drusk/splice-junction-gene-sequences: Recognizes, given a sequence of DNA, the boundaries between exons (the parts of the DNA sequence retained after splicing) and introns (the parts of the DNA sequence that are
Learning the Sequence Determinants of Alternative Splicing from Millions of Random Sequences - ScienceDirect
Predicting Splicing from Primary Sequence with Deep Learning
ORFs, Splicing & Coding
Splicing-out of intron-equivalents
Exon sequences at the splice junctions affect splicing fidelity and alternative splicing | PNAS
RNA Splicing | Learn Science at Scitable
IMGT Education
RNA splicing - Wikipedia
Frontiers | A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals
Nucleotide sequence at the splice junction sequences and sizes of exons... | Download Table
Discerning novel splice junctions derived from RNA-seq alignment: a deep learning approach | BMC Genomics | Full Text
Ultra-deep sequencing reveals pre-mRNA splicing as a sequence driven high-fidelity process | PLOS ONE
Branch Point Identification and Sequence Requirements for Intron Splicing in Plasmodium falciparum | Eukaryotic Cell
Giardia lamblia Hsp90 pre‐mRNAs undergo self‐splicing to generate mature RNA in an in vitro trans‐splicing reaction - Iyer - 2019 - FEBS Letters - Wiley Online Library
Discerning novel splice junctions derived from RNA-seq alignment: a deep learning approach | BMC Genomics | Full Text
Splice Sites (Molecular Biology)
Solved Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' | Chegg.com
Recognition of splice-junction genetic sequences using random forest and Bayesian optimization | SpringerLink
Is PRNP mRNA alternatively spliced?
Consensus sequences and frequencies of human splice site... | Download Scientific Diagram
IJMS | Free Full-Text | Non-Canonical Splicing and Its Implications in Brain Physiology and Cancer
A modified Kohonen network for DNA splice junction classification | Semantic Scholar
