Plants | Free Full-Text | A Core35S Promoter of Cauliflower Mosaic Virus Drives More Efficient Replication of Turnip Crinkle Virus
11
The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed Region | Journal of Virology
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Promoters
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
Addgene: pMpGWB106
CaMV35S promoter – A plant biology and biotechnology workhorse in the era of synthetic biology - ScienceDirect
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials
Domains of the CaMV 35S promoter (Benfey et al., 1990) and enhanced... | Download Scientific Diagram
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Frontiers | Cauliflower mosaic virus (CaMV) Biology, Management, and Relevance to GM Plant Detection for Sustainable Organic Agriculture
Detection of the CaMV-35S Promoter Sequence in Maize Pollen and Seed | Semantic Scholar
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Part:BBa K1825004 - parts.igem.org
Bidirectionalization of polar promoters in plants | Nature Biotechnology
Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato
Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram
